The Ward lab at UC Santa Cruz
  • Home
  • Research
    • Molting
    • Spermatogenesis
    • Tool development
  • People
    • Current Ward Lab Members
    • Former lab members
    • Positions
  • Publications
    • Peer Reviewed Publications
    • Preprints
    • K99 grant writing
    • Our neglected blog
    • Meeting slides >
      • 2017 Worm meeting
      • 2019 Worm meeting
  • Methods & protocols
    • Biochemistry
    • C. elegans
    • Molecular biology
    • pha-1 co-conversion >
      • Strain maintenance
      • cku-80 RNAi
      • Construct and oligo design
      • Generation of PU6::sgRNA templates by PCR fusion
      • Injections
      • FAQs
  • Contact us

Injections

  •  I make a 20 µl of an injection mix consisting of [50 ng/µl of pJW1285 (CRISPR/Cas9 plasmid targeting pha-1)+50 ng/µl pha-1(ts) repair oligo (unpurified 80mer works well)+50 ng/µl of knock-in repair template+25 ng/µl of each PCR-generated PU6::sgRNA template]. Bring up to 20 µl with nuclease-free water. For a new target site, I try screening at least two sgRNAs. If multiplexing, just add 50 ng/µl of the additional repair template and 25 ng/µl of PCR derived PU6::sgRNA template.

  • I filter the injection mixture through a SpinX microfuge tube filter (CoStar) and keep at 4ºC.


  • For each injection mixture, I inject 24-48 animals (more if you get a lot of sterile or dead animals). pha-1(ts) animals can be a bit sickly, so it takes time to get your efficiency up.  Best to inject more animals, as one begins to use pha-1(ts) co-selection. After animals recover from the injection, single P0 animals onto plates.  I like to use 24-well plates seeded with OP50.  Shift plates to 25ºC. On days 3 and/or 4, check the plates.  Record the number of sterile and viable P0s. Look for rescued F1 progeny.  They will be obvious. Aside from the injected P0, they should be the only animals on the plate that develop past L1 or L2.  In my hands, lots of rescued F1s is either really really good or really really bad J For my 2xFLAG::smo-1 knock-in (Ward, 2014) I had 14 rescues, or which 11 were correct. In an experiment with a failed sgRNA, I’ve had up to 46 rescues with no knock-in.  

  • Single these rescued F1s to new OP50 seeded plates. Again, I like 24-well plates.  Best practice is to keep track of which P0 the F1s came from, so that if multiple knock-ins are recovered, one can choose independent knock-ins (ie. from different P0s). Incubate 2-3 days at 25ºC to allow progeny develop.  Remove the parental F1 and perform single-worm PCR on it. I like using 30 µl PCRs using Phusion polymerase (NEB), Phusion HF buffer, and 3 µl of single worm lysate. Five µl of this PCR can be use in a restriction digest to identify knock-ins.  The remaining PCR can be cleaned and sequence to validate hits from the restriction digestion assay.

  •  Growth at 25ºC will allow survival of pha-1(ts) rescued heterozygotes. Genotype pha-1 locus by single worm PCR using oligos caatttggcagccattcatgtg and tcgcgcactactgaatcagagtc

  • CEL-1 or other mismatch recognizing endonucleases are excellent for distinguishing between pha-1(ts) repair homozygotes and heterozygotes.

Strain maintenance
cku-80 RNAi
Construct and oligo design
PU6::sgRNA templates by PCR fusion
FAQs
PDF of methods and consideration
Proudly powered by Weebly
  • Home
  • Research
    • Molting
    • Spermatogenesis
    • Tool development
  • People
    • Current Ward Lab Members
    • Former lab members
    • Positions
  • Publications
    • Peer Reviewed Publications
    • Preprints
    • K99 grant writing
    • Our neglected blog
    • Meeting slides >
      • 2017 Worm meeting
      • 2019 Worm meeting
  • Methods & protocols
    • Biochemistry
    • C. elegans
    • Molecular biology
    • pha-1 co-conversion >
      • Strain maintenance
      • cku-80 RNAi
      • Construct and oligo design
      • Generation of PU6::sgRNA templates by PCR fusion
      • Injections
      • FAQs
  • Contact us